mgkit.utils.sequence module¶
Module containing functions related to sequence data
Note
For those functions without a docstring, look at the same with a underscore (‘_’) prepended.
-
class
mgkit.utils.sequence.
Alignment
(seqs=None)[source]¶ Bases:
object
Simple alignment class
-
add_seqs
(seqs)[source]¶ Add sequences to the alignment
Parameters: seqs (iterable) – iterable that returns (name, seq)
-
get_consensus
(nucl=True)[source]¶ Changed in version 0.1.16: added nucl parameter
The consensus sequence is constructed by checking the nucleotide that has the maximum number of counts for each position in the alignment.
Parameters: nucl (bool) – specify if the alignment is nucleotidic Returns: consensus sequence Return type: str
-
get_position
(pos)[source]¶ Get all characters at a position
Parameters: pos (int) – position to return (0-based) Return str: all characters occuring at the position
-
-
mgkit.utils.sequence.
REV_COMP
= {'A': 'T', 'C': 'G', 'G': 'C', 'T': 'A'}¶ Dictionary containing the complement of each nucleotide sequence
-
mgkit.utils.sequence.
TRANS_TABLE
= {'AAA': 'K', 'AAC': 'N', 'AAG': 'K', 'AAT': 'N', 'ACA': 'T', 'ACC': 'T', 'ACG': 'T', 'ACT': 'T', 'AGA': 'R', 'AGC': 'S', 'AGG': 'R', 'AGT': 'S', 'ATA': 'I', 'ATC': 'I', 'ATG': 'M', 'ATT': 'I', 'CAA': 'Q', 'CAC': 'H', 'CAG': 'Q', 'CAT': 'H', 'CCA': 'P', 'CCC': 'P', 'CCG': 'P', 'CCT': 'P', 'CGA': 'R', 'CGC': 'R', 'CGG': 'R', 'CGT': 'R', 'CTA': 'L', 'CTC': 'L', 'CTG': 'L', 'CTT': 'L', 'GAA': 'E', 'GAC': 'D', 'GAG': 'E', 'GAT': 'D', 'GCA': 'A', 'GCC': 'A', 'GCG': 'A', 'GCT': 'A', 'GGA': 'G', 'GGC': 'G', 'GGG': 'G', 'GGT': 'G', 'GTA': 'V', 'GTC': 'V', 'GTG': 'V', 'GTT': 'V', 'TAA': '*', 'TAC': 'Y', 'TAG': '*', 'TAT': 'Y', 'TCA': 'S', 'TCC': 'S', 'TCG': 'S', 'TCT': 'S', 'TGA': '*', 'TGC': 'C', 'TGG': 'W', 'TGT': 'C', 'TTA': 'L', 'TTC': 'F', 'TTG': 'L', 'TTT': 'F'}¶ Translation table - Universal genetic code
-
mgkit.utils.sequence.
_get_kmers
(seq, k)[source]¶ New in version 0.2.6.
Returns a generator, with every iteration yielding a kmer of size k
Parameters: Yields: str – a portion of seq, of size k with a step of 1
-
mgkit.utils.sequence.
_sequence_signature
(seq, w_size, k_size=4, step=None)[source]¶ New in version 0.2.6.
Returns the signature of a sequence, based on a kmer length, over a sliding window. Each sliding window signature is placed in order into a list, with each element being a
collections.Counter
instance whose keys are the kmer found in that window.Parameters: Returns: a list of
collections.Counter
instances, for each window usedReturn type:
-
mgkit.utils.sequence.
_signatures_matrix
(seqs, w_size, k_size=4, step=None)[source]¶ New in version 0.2.6.
Return a matrix (pandas.DataFrame) where the columns are the kmer found in all sequences seqs and the rows are the a MultiIndex with the first level being the sequnce name and the second the index of the sliding window for which a signature was computed.
Parameters: - seqs (iterable) – iterable that yields a tuple, with the first element being the sequence name and the second the sequence itself
- w_size (int) – size of the sliding window size
- k_size (int) – size of the kmer to use
get_kmers()
- step (int) – step to use in
sliding_window()
, defaults to half of the window size
Returns: a DataFrame where the columns are the kmers and the rows are the signatures of each contigs/windows.
Return type: pandas.DataFrame
-
mgkit.utils.sequence.
_sliding_window
(seq, size, step=None)[source]¶ New in version 0.2.6.
Returns a generator, with every iteration yielding a subsequence of size size, with a step of step.
Parameters: Yields: str – a subsequence of size size and step step
-
mgkit.utils.sequence.
calc_n50
(seq_lengths)[source]¶ Calculate the N50 statistics for a
numpy.array
of sequence lengths.The algorithm finds in the supplied array the element (contig length) for which the sum all contig lengths equal or greater than it is equal to half of all assembled base pairs.
Parameters: seq_lengths (array) – an instance of a numpy array containing the sequence lengths Return int: the N50 statistics value
-
mgkit.utils.sequence.
check_snp_in_seq
(ref_seq, pos, change, start=0, trans_table=None)[source]¶ Check a SNP in a reference sequence if it is a synonymous or non-synonymous change.
Parameters: Return bool: True if it is a synonymous change, False if non-synonymous
-
mgkit.utils.sequence.
convert_aa_to_nuc_coord
(start, end, frame=0)[source]¶ Converts aa coordinates to nucleotidic ones. The coordinates must be from ‘+’ strand. For the ‘-‘ strand, use
reverse_aa_coord()
first.Parameters: Returns: the first element is the converted start and the second element is the converted end
Return type: Note
the coordinates are assumed to be 1-based indices
-
mgkit.utils.sequence.
extrapolate_model
(quals, frac=0.5, scale_adj=0.5)[source]¶ New in version 0.3.3.
Changed in version 0.4.4: returns now the minimum and maximum quality scores found, along with some messages for the stages of the function
Extrapolate a quality model from a list of qualities. It uses internally a LOWESS as the base, which is used to estimate the noise as a normal distribution.
Parameters: Returns: the first element is the qualities fit with a LOWESS, the second element is the distribution, the third is the minimum quality score and the fourth element is the maximum quality score found in the sequences
Return type:
-
mgkit.utils.sequence.
get_contigs_info
(file_name, pp=False)[source]¶ Changed in version 0.2.4: file_name can be a dict name->seq or a list of sequences
New in version 0.2.1.
Given a file name for a fasta file with sequences, a dictionary of name->seq, or a list of sequences, returns the following information in a tuple, or a string if pp is True:
- number of sequences
- total base pairs
- max length
- min length
- average length
- N50 statistic
Parameters: Returns: the returned value depends on the value of pp, if True a formatted string is returned, otherwise the tuple with all values is.
Return type:
-
mgkit.utils.sequence.
get_seq_expected_syn_count
(seq, start=0, syn_matrix=None)[source]¶ Changed in version 0.4.4: if codon contains N or is not a multiple of 3, it is skipped
Calculate the expected number of synonymous and non-synonymous changes in a nucleotide sequence. Assumes that the sequence is already in the correct frame and its length is a multiple of 3.
Parameters: - seq (iterable) – nucleotide sequence (uppercase chars)
- start (int) – frame of the sequence
- syn_matrix (dict) – dictionary that contains the expected number of
changes for a codon, as returned by
get_syn_matrix()
Return tuple: tuple with counts of expected counts (syn, nonsyn)
-
mgkit.utils.sequence.
get_seq_number_of_syn
(ref_seq, snps, start=0, trans_table=None)[source]¶ Given a reference sequence and a list of SNPs, calculates the number of synonymous and non-synonymous SNP.
Parameters: Return tuple: synonymous and non-synonymous counts
-
mgkit.utils.sequence.
get_syn_matrix
(trans_table=None, nuc_list=None)[source]¶ Returns a dictionary containing the expected count of synonymous and non-synonymous changes that a codon can have if one base is allowed to change at a time.
There are 9 possible changes per codon.
Parameters: - trans_table (dict) – a tranlation table, defaults to
seq_utils.TRANS_TABLE
- nuc_list (iterable) – a list of nucleotides in which a base can change,
default to the keys of
seq_utils.REV_COMP
Return dict: returns a dictionary in which for each codon a dictionary {‘syn’: 0, ‘nonsyn’: 0} holds the number of expected changes
- trans_table (dict) – a tranlation table, defaults to
-
mgkit.utils.sequence.
get_syn_matrix_all
(trans_table=None)[source]¶ Same as
get_syn_matrix()
but a codon can change in any of the ones included in trans_table.There are 63 possible changes per codon.
-
mgkit.utils.sequence.
get_variant_sequence
(seq, *snps)[source]¶ New in version 0.1.16.
Return a sequence changed in the positions requested.
Parameters: Returns: string with the changed characters
Return type: Example
>>> get_variant_sequence('ACTGATATATGCGCGCATCT', (1, 'C')) 'CCTGNTGTATGCGCGCATCT'
Note
It is used for nucleotide sequences, but it is valid to use any string
-
mgkit.utils.sequence.
make_reverse_table
(tbl=None)[source]¶ Makes table to reverse complement a sequence by
reverse_complement()
. The table used is the complement for each nucleotide, defaulting toREV_COMP
-
mgkit.utils.sequence.
put_gaps_in_nuc_seq
(nuc_seq, aa_seq, trim=True)[source]¶ Match the gaps in an amino-acid aligned sequence to its original nucleotide sequence. If the nucleotide sequence is not a multiple of 3, the trim option by default trim those bases from the output.
Parameters: Return str: gapped nucleotide sequence
-
mgkit.utils.sequence.
qualities_model_constant
(length=150, scale=1, loc=35)[source]¶ New in version 0.3.3.
Model with constant quality
Parameters: Returns: first element is sequence qualities, the second element contains the distribution used to randomise them
Return type:
-
mgkit.utils.sequence.
qualities_model_decrease
(length=150, scale=None, loc=35)[source]¶ New in version 0.3.3.
The model is a decreasing one, from 35 and depends on the length of the sequence.
Parameters: Returns: first element is sequence qualities, the second element contains the distribution used to randomise them
Return type:
-
mgkit.utils.sequence.
random_qualities
(n=1, length=150, model=None, max_qual=60, min_qual=0)[source]¶ New in version 0.3.3.
Parameters: - n (int) – number of quality arrays to yield
- length (int) – length of the quality array
- model (tuple) – a tuple specifying the qualities and error distribution,
if None
qualities_model_decrease()
is used - max_qual (int) – max quality values allowed, since rarely the quality exceed 60 in sequencing data
Yields: numpy.array – numpy array of qualities, with the maximum value of 60 by default, or max_qual, same with min_qual
-
mgkit.utils.sequence.
random_sequences
(n=1, length=150, p=None)[source]¶ New in version 0.3.3.
Returns an iterator of random squences, where each nucleotide probability can be customised in the order (A, C, T, G)
Parameters: Yields: str – string representing a nucleotidic sequence
-
mgkit.utils.sequence.
random_sequences_codon
(n=1, length=150, codons=['TTT', 'TCT', 'TAT', 'TGT', 'TTC', 'TCC', 'TAC', 'TGC', 'TTA', 'TCA', 'TAA', 'TGA', 'TTG', 'TCG', 'TAG', 'TGG', 'CTT', 'CCT', 'CAT', 'CGT', 'CTC', 'CCC', 'CAC', 'CGC', 'CTA', 'CCA', 'CAA', 'CGA', 'CTG', 'CCG', 'CAG', 'CGG', 'ATT', 'ACT', 'AAT', 'AGT', 'ATC', 'ACC', 'AAC', 'AGC', 'ATA', 'ACA', 'AAA', 'AGA', 'ATG', 'ACG', 'AAG', 'AGG', 'GTT', 'GCT', 'GAT', 'GGT', 'GTC', 'GCC', 'GAC', 'GGC', 'GTA', 'GCA', 'GAA', 'GGA', 'GTG', 'GCG', 'GAG', 'GGG'], p=None, frame=None)[source]¶ New in version 0.3.3.
Returns an iterator of nucleotidic sequences, based on a defined genetic code (passed as parameter, defaults to the universal one). The sequence if first sampled with replacement from the codon list, with a number of codons that covers the length chosen plus an additional one to allow a frame shift as set by frame
Note
If the probability (for each codon) are supplied, the number of sequences required to match those probabilities within a 10% margin of error is of at least 10.000 sequences, for 5% at leas 100.000
Parameters: - n (int) – number of sequences to yield
- length (int) – length of the sequences
- codons (iterable) – codons used when generating the sequences
- p (tuple) – probability of each codon occurence, in the same order as codons
- frame (int or None) – used to define a specific frame shift occuring in the sequence (0 to 2) or a random one (if None)
Yields: str – string representing a nucleotidic sequence
-
mgkit.utils.sequence.
reverse_aa_coord
(start, end, seq_len)[source]¶ Used to reverse amino-acid coordinates when parsing an AA annotation on the - strand. Used when the BLAST or HMMER annotations use AA sequences.
Parameters: Returns: reversed (from strand - to strand +) coordinates. The first element is the converted start and the second element is the converted end
Return type: Note
- start and end are 1-based indices
-
mgkit.utils.sequence.
reverse_complement
(seq, tbl={65: 'T', 67: 'G', 71: 'C', 84: 'A'})[source]¶ Returns the reverse complement of a nucleotide sequence
Parameters: - seq (str) – nucleotide sequence with uppercase characters
- tbl (dict) – translation table returned by
make_reverse_table()
Return str: returns the reverse complement of a nucleotide sequence
-
mgkit.utils.sequence.
reverse_complement_old
(seq, tbl=None)[source]¶ Returns the reverse complement of a nucleotide sequence
Parameters: Return str: returns the reverse complement of a nucleotide sequence
-
mgkit.utils.sequence.
sequence_composition
(sequence, chars=('A', 'T', 'C', 'G'))[source]¶ New in version 0.1.13.
Returns the number of occurences of each unique character in the sequence
Parameters: Yields: tuple – the first element is the nucleotide and the second is the number of occurences in sequence
-
mgkit.utils.sequence.
sequence_gc_content
(sequence)[source]¶ Changed in version 0.3.3: in case of ZeroDivisionError returns .5
New in version 0.1.13.
Calculate GC content information for an annotation. The formula is:
(1)¶\[\frac {(G + C)}{(G + C + A + T)}\]Parameters: sequence (str) – sequence Returns: GC content Return type: float
-
mgkit.utils.sequence.
sequence_gc_ratio
(sequence)[source]¶ New in version 0.1.13.
Calculate GC ratio information for a sequence. The formula is:
(2)¶\[\frac {(A + T)}{(G + C)}\]Parameters: sequence (str) – sequence Returns: GC ratio, or numpy.nan if G = C = 0 Return type: float
-
mgkit.utils.sequence.
translate_sequence
(sequence, start=0, tbl=None, reverse=False)[source]¶ Translate a nucleotide sequence in an amino acid one.
Parameters: - sequence (str) – sequence to translate, it’s expected to be all caps
- start (int) – 0-based index for the translation to start
- tbl (dict) – dictionary with the translation for each codon
- reverse (bool) – if True,
reverse_complement()
will be called and the returned sequence translated
Return str: the translated sequence